Stem-loop sequence mtr-MIR399g

AccessionMI0005588 (change log)
DescriptionMedicago truncatula miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399g
(22 sentences)

Stem-loop
   --uuaca     ugu               agccauaugcuaugauaugcau 
5'        gggca   ucuccuuuggcaggu                      u
          |||||   |||||||||||||||                      g
3'        cccgu   agaggaaaccgucca                      c
   uuaacga     -uu               augugugaguuucucauaccaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 23158805-23158908 [-]
intergenic
chr8: 23994507-23994610 [+]
intergenic
chr8: 24161515-24161618 [+]
intergenic
chr8: 24230599-24230702 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399g
mtr-MIR399gchr8: 24230599-24230702 [+]
mtr-MIR399fchr8: 24222878-24222981 [+]
mtr-MIR399hchr8: 24167198-24167287 [-]
mtr-MIR399gchr8: 24161515-24161618 [+]
mtr-MIR399fchr8: 24153821-24153924 [+]
mtr-MIR399hchr8: 24050903-24050992 [+]
mtr-MIR399hchr8: 24000209-24000298 [-]
mtr-MIR399gchr8: 23994507-23994610 [+]
mtr-MIR399fchr8: 23986801-23986904 [+]
mtr-MIR399fchr8: 23166508-23166611 [-]
mtr-MIR399achr8: 23163782-23163915 [-]
mtr-MIR399gchr8: 23158805-23158908 [-]
mtr-MIR399hchr8: 23153129-23153218 [+]
Database links

Mature sequence mtr-miR399g

Accession MIMAT0011074
Sequence

79 - 

ugccaaaggagauuugcccag

 - 99

Get sequence
Evidence by similarity; MI0001020

References

1
" Bonnet E Unpublished (2007).