Stem-loop sequence mtr-MIR156e

AccessionMI0005595 (change log)
DescriptionMedicago truncatula miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156e
(78 sentences)

Stem-loop
      u u         -              u  -          uuauauauauauauauauauauauauauauauauauauauau 
5' ggu g ugacagaag auagagagcacaga ga ugauaugcau                                          a
   ||| | ||||||||| |||||||||||||| || ||||||||||                                          u
3' cca c acugucuuc uaucucucguguuu cu acuauacgug                                          a
      - u         g              c  c          uuuuaaguagagguacgucgaggucgaggaguauauauauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 31820126-31820297 [+]
intergenic
Database links

Mature sequence mtr-miR156e

Accession MIMAT0011081
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).