Stem-loop sequence mtr-MIR319b

AccessionMI0005596 (change log)
DescriptionMedicago truncatula miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention mtr-MIR319b
(33 sentences)

Stem-loop
   --u   a     uu          cuc     u   aa       u     a -  g   ac       uc  aa  u      aaauaua 
5'    aag gagcu  cuuuagucca   auggg gac  uaagauu caauu g cu cug  ucauuca  ca  ug ugagua       u
      ||| |||||  ||||||||||   ||||| |||  ||||||| ||||| | || |||  |||||||  ||  || ||||||       a
3'    uuc cucga  gaagucaggu   uaucc uug  auucuaa guuaa c ga ggc  aguaagu  gu  ac acucau       g
   cuu   c     gg          uca     u   -a       -     a a  g   gu       ga  aa  u      auacaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 2188491-2188670 [+]
intergenic
Database links

Mature sequence mtr-miR319b-5p

Accession MIMAT0026727
Sequence

6 - 

gagcuuucuuuaguccacuca

 - 26

Get sequence
Evidence experimental; Illumina [3]

Mature sequence mtr-miR319b-3p

Accession MIMAT0011082
Sequence

156 - 

uuggacugaagggagcuccc

 - 175

Get sequence
Evidence experimental; 454 [2], Illumina [3]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).