Stem-loop sequence mtr-MIR171c

AccessionMI0005597 (change log)
DescriptionMedicago truncatula miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention mtr-MIR171c
(60 sentences)

Stem-loop
   a             u       c      --------    -     aauaa   u 
5'  uugagauauuggc ugguuca ucagaa        gaaa caaaa     cac a
    ||||||||||||| ||||||| ||||||        |||| |||||     ||| c
3'  aacuuuauaaccg gccgagu aguuuu        uuuu guuuu     gug u
   a             u       u      aguuuuag    a     -guaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 8935780-8935884 [+]
intergenic
Database links

Mature sequence mtr-miR171c

Accession MIMAT0011083
Sequence

80 - 

ugauugagccgugccaauauu

 - 100

Get sequence
Evidence by similarity; MI0001792

References

1
" Bonnet E Unpublished (2007).