Stem-loop sequence mtr-MIR398b

AccessionMI0005602 (change log)
DescriptionMedicago truncatula miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

3 open access papers mention mtr-MIR398b
(9 sentences)

Stem-loop
   u  ua     u    a     c       ---agcuau    uu 
5'  uc  caggg cgac ugaga cacauga         caua  u
    ||  ||||| |||| ||||| |||||||         ||||   
3'  ag  guccc gcug acucu guguacu         guau  g
   a  uc     c    g     u       caaccuauu    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 37723218-37723304 [+]
intergenic
Database links

Mature sequence mtr-miR398b

Accession MIMAT0011088
Sequence

62 - 

uguguucucaggucgccccug

 - 82

Get sequence
Evidence by similarity; MI0001018

References

1
" Bonnet E Unpublished (2007).