Stem-loop sequence mtr-MIR168a

AccessionMI0005603 (change log)
Previous IDsmtr-MIR168
DescriptionMedicago truncatula miR168 stem-loop
Gene family MIPF0000081; MIR168
Literature search

6 open access papers mention mtr-MIR168a
(23 sentences)

Stem-loop
           c       u  u    aa   --    --auccac      c 
5' cugauuug uuggugc gg cggg  cca  uuac        aguuuc g
   |||||||| ||||||| || ||||  |||  ||||        ||||||  
3' gacuaagc aacuacg uc gccc  ggu  aaug        ucaaag u
           u       u  u    ca   ua    auucccuu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 41779400-41779497 [-]
intergenic
Database links

Mature sequence mtr-miR168a

Accession MIMAT0011089
Previous IDsmtr-miR168
Sequence

6 - 

uugcuuggugcuggucgggaa

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).