Stem-loop sequence mtr-MIR156f

AccessionMI0005605 (change log)
DescriptionMedicago truncatula miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156f
(77 sentences)

Stem-loop
   -  u     a       -            --   aa         aa 
5'  gu uguug cagaaga uagagagcacau  cug  caaacacaa  g
    || ||||| ||||||| ||||||||||||  |||  |||||||||   
3'  ca acaac gucuucu gucucucgugug  gac  guuuguguu  a
   u  u     c       c            uu   aa         ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 4845679-4845772 [-]
intergenic
Database links

Mature sequence mtr-miR156f

Accession MIMAT0011091
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).