Stem-loop sequence mtr-MIR156g

AccessionMI0005607 (change log)
DescriptionMedicago truncatula miR156g stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156g
(78 sentences)

Stem-loop
      u u         -a          u     ugauaugcauacacauauauauacaac 
5' ggu g ugacagaag  uagagggcac aagga                           a
   ||| | |||||||||  |||||||||| |||||                            
3' cca c acugucuuc  aucucucgug uuccu                           u
      - u         ag          u     uuacuuuacguuaauucgaggaggagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 18847298-18847417 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR156g
mtr-MIR156gchr6: 18847298-18847417 [-]
mtr-MIR2630qchr6: 18839111-18839338 [-]
Database links

Mature sequence mtr-miR156g-5p

Accession MIMAT0011093
Sequence

6 - 

uugacagaagauagagggcac

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR156g-3p

Accession MIMAT0026728
Sequence

97 - 

gcucucuagacuucugucauc

 - 117

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).