Stem-loop sequence mtr-MIR399n

AccessionMI0005609 (change log)
DescriptionMedicago truncatula miR399n stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399n
(22 sentences)

Stem-loop
   ag  a       ug     a           uauggugauauuucauuu 
5'   uc uagggca  ucucu uuggcagguga                  g
     || |||||||  ||||| |||||||||||                   
3'   ag aucccgu  agagg aaccguucacu                  a
   ug  c       cg     a           uaaagaucucggaauuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21480330-21480429 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399n
mtr-MIR5281echr6: 21484129-21484271 [+]
mtr-MIR399nchr6: 21480330-21480429 [-]
Database links

Mature sequence mtr-miR399n

Accession MIMAT0011095
Sequence

75 - 

ugccaaaggagagcugcccua

 - 95

Get sequence
Evidence by similarity; MI0001022

References

1
" Bonnet E Unpublished (2007).