Stem-loop sequence mtr-MIR399o

AccessionMI0005610 (change log)
DescriptionMedicago truncatula miR399o stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399o
(22 sentences)

Stem-loop
   ag  a       ug     a           u     auuu  -  u 
5'   uc uagggca  ucucu uuggcagguga auuuc    ga cu a
     || |||||||  ||||| ||||||||||| |||||    || ||  
3'   ag gucccgu  agagg aaccguucacu uaaag    cu gg g
   ug  c       cg     a           -     --au  c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21465345-21465436 [-]
intergenic
Database links

Mature sequence mtr-miR399o

Accession MIMAT0011096
Sequence

67 - 

ugccaaaggagagcugcccug

 - 87

Get sequence
Evidence by similarity; MI0001020

References

1
" Bonnet E Unpublished (2007).