Stem-loop sequence mtr-MIR398c

AccessionMI0005611 (change log)
DescriptionMedicago truncatula miR398c stem-loop
Gene family MIPF0000107; MIR398
Literature search

3 open access papers mention mtr-MIR398c
(9 sentences)

Stem-loop
   uuc  -     c     c    c       a uuaucau      cu 
5'    ca caggg cgacc gaga cacauga g       augugu  a
      || ||||| ||||| |||| ||||||| |       ||||||  a
3'    gu guccc gcugg cucu gugugcu c       uacaca  g
   -aa  c     c     a    u       - -------      uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 3345232-3345318 [-]
intergenic
Database links

Mature sequence mtr-miR398c

Accession MIMAT0011097
Sequence

62 - 

uguguucucaggucgccccug

 - 82

Get sequence
Evidence by similarity; MI0001019

References

1
" Bonnet E Unpublished (2007).