Stem-loop sequence mtr-MIR164b

AccessionMI0005612 (change log)
DescriptionMedicago truncatula miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

4 open access papers mention mtr-MIR164b
(62 sentences)

Stem-loop
   -  a     a    ca         caau         ugaacauacacacaugauggaagugaauacaaa 
5'  ca gaugg gaag  gggcacgug    acuaacuca                                 g
    || ||||| ||||  |||||||||    |||||||||                                 a
3'  gu cuacc cuuc  cccguguac    ugauugagu                                 g
   a  a     c    uc         uucu         uaauuuuuuuacuuuguauucucuuacaucuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 19001248-19001391 [+]
intergenic
Database links

Mature sequence mtr-miR164b

Accession MIMAT0011098
Sequence

6 - 

uggagaagcagggcacgugca

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).