Stem-loop sequence mtr-MIR156h

AccessionMI0005613 (change log)
DescriptionMedicago truncatula miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156h
(77 sentences)

Stem-loop
   ugc  u          -             -u     a    --a  g 
5'    ug ugacagaaga uagagagcacaga  gauga augc   ug a
      || |||||||||| |||||||||||||  ||||| ||||   || a
3'    ac acugucuucu auuucucguguuu  uuacu uacg   ac g
   -cc  u          u             cc     c    gua  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 24257584-24257677 [+]
intergenic
Database links

Mature sequence mtr-miR156h-5p

Accession MIMAT0011099
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2], Illumina [3]

Mature sequence mtr-miR156h-3p

Accession MIMAT0026729
Sequence

71 - 

gcucuuuauucuucugucauc

 - 91

Get sequence
Evidence experimental; Illumina [3]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).