Stem-loop sequence mtr-MIR164c

AccessionMI0005616 (change log)
DescriptionMedicago truncatula miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

4 open access papers mention mtr-MIR164c
(62 sentences)

Stem-loop
   - uu          ca            ccgu    cucucu 
5'  c  guuggagaag  gggcacgugcaa    agau      c
    |  ||||||||||  ||||||||||||    ||||      a
3'  g  caaccuuuuc  cucgugcacguu    ucua      a
   a uu          ac            uuac    acuuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 36370118-36370203 [-]
intergenic
Database links

Mature sequence mtr-miR164c

Accession MIMAT0011102
Sequence

6 - 

uggagaagcagggcacgugca

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).