Stem-loop sequence mtr-MIR164d

AccessionMI0005617 (change log)
DescriptionMedicago truncatula miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

4 open access papers mention mtr-MIR164d
(62 sentences)

Stem-loop
   -  c u      a     -          --     u 
5'  ca g uggaga gcagg gcacaugcuu  gauuu a
    || | |||||| ||||| ||||||||||  ||||| u
3'  gu c accucu cguuc cguguacgag  uugaa c
   g  a u      -     u          uc     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 5531977-5532048 [+]
intergenic
Database links

Mature sequence mtr-miR164d

Accession MIMAT0011103
Sequence

6 - 

uggagaagcagggcacaugcu

 - 26

Get sequence
Evidence by similarity; MI0001469

References

1
" Bonnet E Unpublished (2007).