Stem-loop sequence mtr-MIR171d

AccessionMI0005619 (change log)
DescriptionMedicago truncatula miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention mtr-MIR171d
(53 sentences)

Stem-loop
   aa            c       c       aagugau       -    a   ag 
5'   ugagauauuggc ugguuca ucagacc       aaaccac uaag uac  u
     |||||||||||| ||||||| |||||||       ||||||| |||| |||   
3'   acucuauaaccg gccgagu aguuugg       uuuggug guuc aug  a
   uc            u       u       -----gu       u    -   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 20063684-20063788 [-]
intergenic
Database links

Mature sequence mtr-miR171d

Accession MIMAT0011105
Sequence

80 - 

ugauugagccgugccaauauc

 - 100

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).