Stem-loop sequence mtr-MIR156i

AccessionMI0005626 (change log)
DescriptionMedicago truncatula miR156i stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156i
(77 sentences)

Stem-loop
   -gauau        -    -        au    c  u         a 
5'       ugacagaa gaga gugagcac  gcug ag gauuguaug u
         |||||||| |||| ||||||||  |||| || |||||||||  
3'       acugucuu cucu cacucgug  uggu uc uuaacauac a
   uauucu        u    u        cg    -  -         g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 46126859-46126951 [-]
intergenic
Database links

Mature sequence mtr-miR156i-5p

Accession MIMAT0011112
Sequence

6 - 

ugacagaagagagugagcac

 - 25

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR156i-3p

Accession MIMAT0026733
Sequence

67 - 

ugcucacuucucuuucugucauc

 - 89

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).