Stem-loop sequence mtr-MIR171f

AccessionMI0005627 (change log)
DescriptionMedicago truncatula miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention mtr-MIR171f
(53 sentences)

Stem-loop
   ---g   a        ug             -- g    u      aua 
5'     aug gauauugg  cgguucaaucaga  a gcag gcuuuu   a
       ||| ||||||||  |||||||||||||  | |||| ||||||    
3'     ugc cuauaacc  gccgaguuaguuu  u uguc cgaaaa   u
   auug   a        gu             au g    u      acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 46694027-46694121 [-]
intergenic
Database links

Mature sequence mtr-miR171f

Accession MIMAT0011113
Sequence

70 - 

uugagccgugccaauaucacg

 - 90

Get sequence
Evidence by similarity; MI0000990

References

1
" Bonnet E Unpublished (2007).