Stem-loop sequence mtr-MIR399p

AccessionMI0005634 (change log)
DescriptionMedicago truncatula miR399p stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399p
(22 sentences)

Stem-loop
   aaca        c      cc        aaaaag   u 
5'     auagggca cucucu  uggcaagu      ggc c
       |||||||| ||||||  ||||||||      ||| a
3'     ugucccgu gagagg  accguuca      ccg g
   ucgg        u      aa        --auaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR399p

Accession MIMAT0011120
Sequence

54 - 

ugccaaaggagaguugcccug

 - 74

Get sequence
Evidence by similarity; MI0001022

References

1
" Bonnet E Unpublished (2007).