Stem-loop sequence cre-MIR905

AccessionMI0005698 (change log)
DescriptionChlamydomonas reinhardtii miR905 stem-loop
Stem-loop
   u    g                                                                    a        c    -g                       a  c          - gacaagcaagcuugggg 
5'  gccg gcuggggccgggcgggcugugaucgaccuggaggucccuggauauggcaccuucgagguuguggucac cacucagu cggg  accucggcccaguugcuggugcu ug ucugacuacc c                 c
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||  ||||||||||||||||||||||| || |||||||||| |                 c
3'  cggc cgaccccggcccgcccgacacuagcuggaccuccagggaccuauaccguggaagcuccaacaccagug gugaguca gccc  uggagccgggucagcgaucacga ac agacugaugg g                 g
   a    g                                                                    c        c    aa                       g  a          c uccugguuacacccccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. and Zhao et al agree that the predominant product from this hairpin precursor is from the 3' arm [1,2]. The product shown here is as described in [2], offset slightly from that described in [1]. Molner et al also identify a number of further offset and overlapping minor products, not shown here [2].

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_75: 370850-371142 [+]
intergenic
Database links

Mature sequence cre-miR905-5p

Accession MIMAT0004964
Previous IDscre-miR905*
Sequence

38 - 

aggucccuggauauggcacc

 - 57

Get sequence
Evidence experimental; cloned [2]

Mature sequence cre-miR905-3p

Accession MIMAT0004386
Previous IDscre-miR905
Sequence

235 - 

aaggugccauauccagggacc

 - 255

Get sequence
Evidence experimental; cloned [1-2]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).
2
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).