Stem-loop sequence cre-MIR906

AccessionMI0005699 (change log)
DescriptionChlamydomonas reinhardtii miR906 stem-loop
Literature search

1 open access papers mention cre-MIR906
(39 sentences)

Stem-loop
                                                      u                  g 
5' ggccuacauacgguuggugggcgugaucagcagggggaagcuuuaucggaa ucgaugugcagggcgugu g
   ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||  
3' ccggauguaugccaaccacccgcacuagucgucccccuucgaaauagccuu agcuacacgucccguaca g
                                                      u                  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_1: 186394-186537 [+]
intergenic
Database links

Mature sequence cre-miR906-5p

Accession MIMAT0004387
Sequence

11 - 

cgguuggugggcgugaucagc

 - 31

Get sequence
Evidence experimental; cloned [1]

Mature sequence cre-miR906-3p

Accession MIMAT0004388
Sequence

95 - 

uccgauaaagcuucccccugc

 - 115

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).