Stem-loop sequence cre-MIR908

AccessionMI0005701 (change log)
DescriptionChlamydomonas reinhardtii miR908 stem-loop
Stem-loop
       gu      a   ug            u       ugaca           c     c     c         g                    ----            ccc 
5' gugg  uuugag aga  cgguccguuggc auaaugu     gaccacccgcu ccuua ugacg aguugacgc uuugauagcaggaucauagu    acgggaccaguu   c
   ||||  |||||| |||  |||||||||||| |||||||     ||||||||||| ||||| ||||| ||||||||| ||||||||||||||||||||    ||||||||||||    
3' cacu  aaacuc ucu  gccaggcaaccg uauuaca     cuggugggcga ggaau acugc ucaacugcg aaacuaucguccuaguauca    ugcccuggucaa   u
       gu      c   ug            u       uauaa           c     a     a         g                    ccaa            cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Zhao et al. identify a mature miRNA product from the 5' arm of the hairpin precursor, and named it miR908 [1]. Molner et al. identify 3 mature products, and suggest that an alternative 5' product is the predominant one, named cre-miR908.1 here [2]. The Zhao et al. product is renamed miR908.2 here.

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_213: 20092-20321 [+]
intergenic
Database links

Mature sequence cre-miR908.1

Accession MIMAT0004965
Sequence

9 - 

ugagaagaugcgguccguuggc

 - 30

Get sequence
Evidence experimental; cloned [2]

Mature sequence cre-miR908.2

Accession MIMAT0004390
Previous IDscre-miR908
Sequence

71 - 

ugacgcguuugauagcaggauc

 - 92

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence cre-miR908.3

Accession MIMAT0004966
Sequence

161 - 

acuacgucaauaaggcagc

 - 179

Get sequence
Evidence experimental; cloned [2]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).
2
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).