Stem-loop sequence cre-MIR909

AccessionMI0005702 (change log)
DescriptionChlamydomonas reinhardtii miR909 stem-loop
Stem-loop
              c                                               c       uc                      a                      c               a         ----       a        a                 a                 c         u  ggcuccugcugcaccggcaguagcgcca 
5' guucccgcaca guggcugaaggucgcggagcucuuugccgacacgguggccauguggu ccgcagc  cuugccacacgggcaugcaaac ugacccugaauggcccugccug ggccugccccgcucc gggccuucu    gcugcug uggugcag ugcggcuggugcugguc aaccgguggugguggug uggugcugu cg                            g
   ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||    ||||||| |||||||| ||||||||||||||||| ||||||||||||||||| ||||||||| ||                            c
3' caagggcgugu caccgacuuccagugccucgggaagcggcugugccaccgguacacca ggcgucg  gaacggugugcccguacguuug acugggacuuaccgggacggac ccggacggggcgagg cucggaaga    cgacgac accacguc acgccgaccacgaccag uuggccaccaccaccac accacgacg gc                            a
              u                                               u       ca                      a                      -               c         uagg       c        c                 c                 c         -  gaccgccggcgggacauggacgaggucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Zhao et al. identify a pair of mature miRNA product from the 5' and 3' arms of the hairpin precursor, and named them miR909-5p and miR909-3p [1]. Molner et al. suggest that an alternative 5' product is the predominant one, named cre-miR909.1 here [2]. The Zhao et al. products are renamed miR909.2 and miR909.3 here. Molner et al. also show a number of offset and overlapping minor products originating from the same hairpin [2], but not catalogued here.

Database links

Mature sequence cre-miR909.2

Accession MIMAT0004391
Previous IDscre-miR909-5p
Sequence

84 - 

augcaaacaugacccugaaug

 - 104

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence cre-miR909.1

Accession MIMAT0004967
Sequence

167 - 

ugcuggucaaaccgguggugg

 - 187

Get sequence
Evidence experimental; cloned [2]

Mature sequence cre-miR909.3

Accession MIMAT0004392
Previous IDscre-miR909-3p
Sequence

370 - 

uucagggucaaguuugcaugc

 - 390

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).
2
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).