Stem-loop sequence cre-MIR910

AccessionMI0005703 (change log)
DescriptionChlamydomonas reinhardtii miR910 stem-loop
Literature search

1 open access papers mention cre-MIR910
(37 sentences)

Stem-loop
     g                   c    --      ---   -   g                        a     c                    c    c - c         g 
5' cc cugcagccggucaggugca ccgg  aggugc   cgg agc guugggguugcggggcccgcaggu gcugc guugagcccgacgcugcugc gccg g c ggugcugcu c
   || ||||||||||||||||||| ||||  ||||||   ||| ||| |||||||||||||||||||||||| ||||| |||||||||||||||||||| |||| | | |||||||||  
3' gg gacgucggccaguccacgu ggcc  uccacg   gcc ucg cgaccccgacgcccugggcgucca cgacg cagcucgggcugcgacgacg cggc c g ccacgacgg g
     -                   c    ag      uca   a   a                        c     c                    u    - a u         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. confirm that the mature miRNA product identified by Zhao et al. and shown here is the predominant one [2]. They also identify 2 further minor products from the 3' arm, not shown here.

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_17: 966108-966334 [+]
intergenic
Database links

Mature sequence cre-miR910

Accession MIMAT0004393
Sequence

134 - 

agcagcgucgggcucgaccgc

 - 154

Get sequence
Evidence experimental; cloned [1-2]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).
2
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).