Stem-loop sequence cre-MIR912

AccessionMI0005705 (change log)
DescriptionChlamydomonas reinhardtii miR912 stem-loop
Stem-loop
       augc         -  a      g -----   c     aag            a       aa  uaaug         ----c         aca  a         u                    g                             a    a         g 
5' gccu    cucugccgg cc ucaaug c     gcu acgac   ggugccaucguc ccggucu  uc     ccaggcaac     agggaagac   gg uccauuuuc agugccuggcugggaucaau caagaugauaguuggauccuggacgccga ggcc ucaugcggu u
   ||||    ||||||||| || |||||| |     ||| |||||   |||||||||||| |||||||  ||     |||||||||     |||||||||   || ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||  
3' cgga    gaggcggcc gg aguuac g     cgg ugcug   ccacgguagcag ggccaga  ag     gguccguug     ucccuucug   cc agguagagg ucgcggaccgacccuaguua guucugcugucgaucuaggaccugcgguu ccgg aguacgcca c
       ccaa         c  c      g gaccu   u     cca            c       cg  ccuug         uuccc         gca  c         u                    g                             g    c         a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Molner et al. confirm that the mature miRNA product identified by Zhao et al. and shown here is the predominant one [2]. They also identify 3 further minor products from the same hairpin, not shown here.

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_35: 929764-930115 [-]
intergenic
Database links

Mature sequence cre-miR912

Accession MIMAT0004395
Sequence

216 - 

uggauugaucccagccaggc

 - 235

Get sequence
Evidence experimental; cloned [1-2]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).
2
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).