Stem-loop sequence cre-MIR913

AccessionMI0005706 (change log)
DescriptionChlamydomonas reinhardtii miR913 stem-loop
Stem-loop
                                   c         c  c                                                        c         -c   acuu  gu 
5' guaucugugucgcucaugcaagggacagccaa gaauucccu gc acguuuugggggcuugcacacuugcgaguccguggccguguuuccaaggauguaua aagcgaagu  gag    ug  a
   |||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||  |||    ||   
3' cauagacacagcgaguacguucccugucgguu cuuaaggga cg ugcaaagcccccgaacguguggacgcucaggcaccggcacagagguucuuacauau uucgcuuca  cuc    ac  u
                                   u         c  c                                                        u         cc   --au  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Zhao et al. identified a mature miRNA product from the 3' arm of this hairpin precursor, and named it miR913 [1]. Molner et al. show that predominant product originates from the 5' arm [2]. The 3' product is renamed miR913* here. Molner et al. also identify a number of minor products from the same hairpin, not catalogued here.

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_6: 118495-118743 [-]
intergenic
Database links

Mature sequence cre-miR913-5p

Accession MIMAT0004968
Previous IDscre-miR913
Sequence

61 - 

ugcacacuugcgaguccgugg

 - 81

Get sequence
Evidence experimental; cloned [2]

Mature sequence cre-miR913-3p

Accession MIMAT0004396
Previous IDscre-miR913;cre-miR913*
Sequence

171 - 

acggacucgcaggugugcaag

 - 191

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).
2
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).