Stem-loop sequence cre-MIR915

AccessionMI0005708 (change log)
DescriptionChlamydomonas reinhardtii miR915 stem-loop
Literature search

1 open access papers mention cre-MIR915
(1 sentences)

Stem-loop
                    c                g  -                 c            a            a       a          a    c                           u g  cc  u 
5' caacgcugccgcggagg gcucggcguggacggg ac gagcucggcgaccuucu uuuacgcugucg aacuaucggagg gcagcuc aauucuuucc auag cgcuggcaauaaggcaaucguugcguu g gu  uc c
   ||||||||||||||||| |||||||||||||||| || ||||||||||||||||| |||||||||||| |||||||||||| ||||||| |||||||||| |||| ||||||||||||||||||||||||||| | ||  || g
3' guugcgacggcgccucc cgagccgcaccugccc ug cucgagccgcuggaaga aaaugcgacagc uugauagccucc cgucgag uuaagaaagg uauc gcgacuguuauuccguuagcaacgcaa c cg  ag c
                    -                g  g                 a            c            c       c          c    c                           - g  uc  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_23: 1270775-1271060 [-]
intergenic
Database links

Mature sequence cre-miR915

Accession MIMAT0004398
Sequence

109 - 

uggcaauaaggcaaucguugc

 - 129

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).