Stem-loop sequence cre-MIR919

AccessionMI0005709 (change log)
DescriptionChlamydomonas reinhardtii miR919 stem-loop
Gene family MIPF0000374; MIR918
Stem-loop
                                        c    -  ac  u         a  uc                       u                   a     a         c       a 
5' aaugcgggacgucugcgccgcacaugucucaggagga aucg cc  ua uagcaagcu cu  aggguaucucggucagcauuucg uuggcaagauguccgcuuc gguac cgccgcuca gcgauga g
   ||||||||||||||||||||||||||||||||||||| |||| ||  || ||||||||| ||  ||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| ||||||| g
3' uuaugcucugcagacguggcguguacagaguccuucu uagc gg  au aucguucga ga  ucccauagagccagucguagagc aaccguucugcaggugagg ccaug gcggcgagu cgcuacu c
                                        c    a  -c  c         c  cc                       u                   c     c         a       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Zhao et al. and Molner et al. independently identified a number of miR/miR* pairs expressed from this hairpin precursor [1,2]. The predominant product by extensive cloning is named here miR919.1 [2]. The second product (miR919.2) is also shown, but others are omitted for clarity.

Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_6: 1014120-1014384 [-]
intergenic
Clustered miRNAs
< 10kb from cre-MIR919
cre-MIR919scaffold_6: 1014120-1014384 [-]
cre-MIR918scaffold_6: 1014118-1014386 [+]
Database links

Mature sequence cre-miR919.2

Accession MIMAT0004399
Previous IDscre-miR919-5p.1
Sequence

27 - 

ucucaggaggacaucgccacu

 - 47

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence cre-miR919.1

Accession MIMAT0004969
Sequence

177 - 

aaucgagaugcugaccgagau

 - 197

Get sequence
Evidence experimental; cloned [2]

References

1
PMID:17470535 "A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii" Zhao T, Li G, Mi S, Li S, Hannon GJ, Wang XJ, Qi Y Genes Dev. 21:1190-1203(2007).
2
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).