![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-509-3 |
||||||||||
Accession | MI0005717 (change log) | |||||||||
Symbol | HGNC:MIR509-3 | |||||||||
Description | Homo sapiens miR-509-3 stem-loop | |||||||||
Gene family | MIPF0000130; mir-506 | |||||||||
Literature search |
![]()
32 open access papers mention hsa-mir-509-3 | |||||||||
Stem-loop |
-- ug c - ug g --g u 5' g guac cua c cagacgug caaucau ua a | |||| ||| | |||||||| ||||||| || 3' c caug gau g gucugcau guuagua au a ua gu a g gu g aaa u |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence hsa-miR-509-3-5p |
|
Accession | MIMAT0004975 |
Sequence |
10 - uacugcagacguggcaaucaug - 31 |
Deep sequencing | 47149 reads, 84 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-509-3p |
|
Accession | MIMAT0002881 |
Previous IDs | hsa-miR-509 |
Sequence |
44 - ugauugguacgucuguggguag - 65 |
Deep sequencing | 142713 reads, 70 experiments |
Evidence | experimental; array-cloned [1], cloned [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17573847
"Analysis of gene expression in normal and neoplastic human testis: new roles of RNA"
Int J Androl. 30:316-326(2007).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|