Stem-loop sequence ame-let-7

AccessionMI0005726 (change log)
DescriptionApis mellifera let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

7 open access papers mention ame-let-7
(20 sentences)

Stem-loop
   ---a     c     u   g                a  gaauggaaauuc 
5'     cgaug cuggg gag uaguagguuguauagu gg            g
       ||||| ||||| ||| |||||||||||||||| ||             
3'     gcugc ggccc uuc aucguucaacauguca cc            c
   cgca     u     u   a                -  ugaagcauauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 8436647-8436746 [+]
intergenic
Clustered miRNAs
< 10kb from ame-let-7
ame-mir-100CM000061.5: 8436007-8436106 [+]
ame-let-7CM000061.5: 8436647-8436746 [+]
ame-mir-125CM000061.5: 8437175-8437281 [+]
Database links

Mature sequence ame-let-7-5p

Accession MIMAT0004418
Sequence

13 - 

ugagguaguagguuguauagu

 - 33

Get sequence
Evidence experimental; array [1], RTPCR [2], Illumina [3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).