Stem-loop ame-mir-13a

Accession

MI0005730

Description

Apis mellifera ame-mir-13a precursor miRNA

Literature search

3 open access papers mention ame-mir-13a
(7 sentences)

Sequence

accgaaaugaaaauaccuuuugcgguccgauacaucaaauugguuguggaauguuucgagucaUAUCACAGCCAUUUUGAUGAGcuuggcccgcagaauc
.................((((((((.((((..(((((((.(((((((((.(((........))).))))))))).)))))))...)))).))))))))..

Structure

accgaaaugaaaauacc        u    -ua       u         a   uuu 
                 uuuugcgg ccga   caucaaa ugguugugg aug   c
                 |||||||| ||||   ||||||| ||||||||| |||    
                 aagacgcc gguu   GUAGUUU ACCGACACU Uac   g
---------------cu        c    cGA       U         A   uga 

Annotation confidence Low

Genome context

CM000054.5: 1246352-1246451 [+]

Clustered miRNAs

6 other miRNAs are < 10 kb from ame-mir-13a

Mature ame-miR-13a-3p

• Accession: MIMAT0004422
• Description: Apis mellifera ame-miR-13a-3p mature miRNA
• Sequence: 64 - UAUCACAGCCAUUUUGAUGAG - 84
• Evidence: experimental ; RTPCR [2], Illumina [3-4]

References

1. PubMed ID: 17543122
   Computational and transcriptional evidence for microRNAs in the honey bee genome
   Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG
   Genome Biol (2007) 8:R97


2. PubMed ID: 22409512
   Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome
   "Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y"
   "Genes Brain Behav (2012) 11:660-670


3. PubMed ID: 20491979
   Correlated expression patterns of microRNA genes with age-dependent behavioural changes in honeybee
   "Behura SK, Whitfield CW"
   "Insect Mol Biol (2010) 19:431-439


4. PubMed ID: 26853694
   MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)
   "Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL"
   "Insect Mol Biol (2016) 25:216-226