Stem-loop sequence ame-mir-275

AccessionMI0005733 (change log)
DescriptionApis mellifera miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

2 open access papers mention ame-mir-275
(3 sentences)

Stem-loop
   aaacguuacuug    g    a           -         ua     ugc aa 
5'             ucgu cgca cgcgcguuacu cggguacuu  ggcug   c  u
               |||| |||| ||||||||||| |||||||||  |||||   |   
3'             agcg gcgu gcgcgcgauga guccaugga  cugac   g  u
   ----------aa    -    c           a         --     uaa cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 10532636-10532735 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-275
ame-mir-275CM000060.5: 10532636-10532735 [-]
ame-mir-305CM000060.5: 10532413-10532502 [-]
Database links

Mature sequence ame-miR-275-3p

Accession MIMAT0004424
Sequence

67 - 

ucagguaccugaaguagcgcgcg

 - 89

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).