Stem-loop sequence ame-mir-279a

AccessionMI0005734 (change log)
Previous IDsame-mir-279
DescriptionApis mellifera miR-279 stem-loop
Gene family MIPF0000184; mir-279
Literature search

3 open access papers mention ame-mir-279a
(5 sentences)

Stem-loop
   agaaaaugaaaaaauuu       u   ca        aa        g     aaa 
5'                  ccugaau ugc  aaugagug  ggucuagu cacag   a
                    ||||||| |||  ||||||||  |||||||| |||||   u
3'                  ggacuug aug  uuacucac  cuagauca guguu   g
   ----------------u       c   aa        ac        -     aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 9792013-9792112 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-279a
ame-mir-279aCM000058.5: 9792013-9792112 [-]
ame-mir-996CM000058.5: 9791793-9791883 [-]
Database links

Mature sequence ame-miR-279a-3p

Accession MIMAT0004425
Previous IDsame-miR-279
Sequence

67 - 

ugacuagauccacacucauuaa

 - 88

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).