Stem-loop sequence ame-mir-283

AccessionMI0005735 (change log)
DescriptionApis mellifera miR-283 stem-loop
Gene family MIPF0000054; mir-216
Literature search

4 open access papers mention ame-mir-283
(5 sentences)

Stem-loop
   ---aauaa  ug  ga       aa        u  u         a  uug 
5'         uc  gu  uguaguc  auaucagc gg aauucuggg uu   a
           ||  ||  |||||||  |||||||| || ||||||||| ||    
3'         ag  ca  gcaucgg  uauggucg uc uuaggaccc aa   c
   ccgcuagc  gu  -a       cc        u  -         -  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 3364239-3364338 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-283
ame-mir-283CM000055.5: 3364239-3364338 [-]
ame-mir-3477CM000055.5: 3363469-3363567 [-]
ame-mir-12CM000055.5: 3362974-3363056 [-]
Database links

Mature sequence ame-miR-283-5p

Accession MIMAT0004426
Sequence

21 - 

aaauaucagcugguaauucu

 - 40

Get sequence
Evidence experimental; RTPCR [1-2], Illumina [3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).