Stem-loop sequence ame-mir-34

AccessionMI0005739 (change log)
DescriptionApis mellifera miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

7 open access papers mention ame-mir-34
(23 sentences)

Stem-loop
   uuu           g    uug         u    u         -  ua 
5'    uuuugcgauug caug   gcaguguug uagc gguugugug gc  c
      ||||||||||| ||||   ||||||||| |||| ||||||||| ||   
3'    gggaugcuagc guau   cgucacggc aucg ccagcauau ug  a
   --u           a    uaa         u    -         a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 6962684-6962783 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-34
ame-mir-277CM000058.5: 6958025-6958108 [+]
ame-mir-3730CM000058.5: 6958614-6958707 [+]
ame-mir-34CM000058.5: 6962684-6962783 [+]
Database links

Mature sequence ame-miR-34-5p

Accession MIMAT0004430
Sequence

21 - 

uggcaguguuguuagcugguug

 - 42

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).