Stem-loop sequence ame-mir-190

AccessionMI0005750 (change log)
DescriptionApis mellifera miR-190 stem-loop
Gene family MIPF0000076; mir-190
Literature search

2 open access papers mention ame-mir-190
(4 sentences)

Stem-loop
   caaacaagucg    gu u      -            au         u   u 
5'            ucug  u ccguaa gauauguuugau  ucuugguug uuu u
              ||||  | |||||| ||||||||||||  ||||||||| ||| a
3'            agac  g gguauu uuauacaaacua  aggaccagc aag a
   --------aaa    ug u      a            --         u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Weaver et al. identify this bee homolog of human mir-190b [1]. They also report a second predicted hairpin on the opposite strand, with RT-PCR evidence for the expression of a second mature miRNA (UAAUAAUAUGUUUGAUUCCUGG).

Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000064.5: 9278012-9278111 [+]
intergenic
Database links

Mature sequence ame-miR-190-5p

Accession MIMAT0004440
Sequence

25 - 

agauauguuugauauucuugguuguu

 - 50

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).