miRBase entry: hsa-mir-940

Stem-loop hsa-mir-940


Accession
MI0005762
Symbol
HGNC: MIR940
Description
Homo sapiens hsa-mir-940 precursor miRNA
Gene family
MIPF0000540; mir-940

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR940 is a microRNA (miRNA) that has been implicated in various biological processes and diseases, including hepatocellular carcinoma (HCC) cell viability and invasion [PMC6433657]. MiRNAs are short non-coding RNAs that regulate gene expression by binding to the 3'-untranslated region (UTR) of target messenger RNAs (mRNAs) [PMC6433657]. They play important roles in tumor biology, including cell proliferation, migration, apoptosis, and metastasis [PMC6433657]. In the context of nasopharyngeal carcinoma (NPC), several miRNAs have been found to be closely associated with its occurrence and development [PMC7534087]. For example, miR-17-5p has been shown to promote NPC cell proliferation by inhibiting p21 expression [PMC7534087]. Additionally, let-7a down-regulates HMGA2 expression level, inhibiting NPC cell invasion and epithelial-mesenchymal transition process [PMC7534087]. MiR-548 and MIR940 have been identified as potential diagnostic biomarkers for NPC with high sensitivity and specificity [PMC7534087][PMC7072613][PMC5737662][PMC6700302[PMC7072613][PMC5737662][PMC6700302]. Furthermore, an integrated analysis of miRNA and mRNA microarray data revealed that the hsa-miR-423-5p/MYC signature is pivotal for NPC diagnosis [PMC7534087][PMC9924325[PMC9924325]. MIR940 has also been implicated in other cancers such as pancreatic cancer and gastric cancer [PMC7250935][PMC4944467[PMC4944467]. In summary, MIR940 is a miRNA that plays important roles in various biological processes and diseases.

Literature search
36 open access papers mention hsa-mir-940
(333 sentences)

Sequence

3260 reads, 104 reads per million, 81 experiments
gugaggugugggcccggccccaggagcggggccugggcagccccguguguugaggaaggAAGGCAGGGCCCCCGCUCCCCgggccugaccccac
(((.(((..((((((((.....((((((((((((.(.(..((((.........))..))..).).))).))))))))))))))))).))).)))

Structure
   a   gu        cccca         -   g g ag  --  gug 
gug ggu  gggcccgg     ggagcgggg ccu g c  cc  cc   u
||| |||  ||||||||     ||||||||| ||| | |  ||  ||   g
cac cca  uccgggCC     CCUCGCCCC GGG C G  gg  gg   u
   c   -g        -----         C   A G AA  aa  agu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr16: 2271747-2271840 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-940
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-940 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-940

Accession MIMAT0004983
Description Homo sapiens hsa-miR-940 mature miRNA
Sequence 60 - AAGGCAGGGCCCCCGCUCCCC - 80
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043