MIR940 is a microRNA (miRNA) that has been implicated in various biological processes and diseases, including hepatocellular carcinoma (HCC) cell viability and invasion [PMC6433657]. MiRNAs are short non-coding RNAs that regulate gene expression by binding to the 3'-untranslated region (UTR) of target messenger RNAs (mRNAs) [PMC6433657]. They play important roles in tumor biology, including cell proliferation, migration, apoptosis, and metastasis [PMC6433657]. In the context of nasopharyngeal carcinoma (NPC), several miRNAs have been found to be closely associated with its occurrence and development [PMC7534087]. For example, miR-17-5p has been shown to promote NPC cell proliferation by inhibiting p21 expression [PMC7534087]. Additionally, let-7a down-regulates HMGA2 expression level, inhibiting NPC cell invasion and epithelial-mesenchymal transition process [PMC7534087]. MiR-548 and MIR940 have been identified as potential diagnostic biomarkers for NPC with high sensitivity and specificity [PMC7534087][PMC7072613][PMC5737662][PMC6700302[PMC7072613][PMC5737662][PMC6700302]. Furthermore, an integrated analysis of miRNA and mRNA microarray data revealed that the hsa-miR-423-5p/MYC signature is pivotal for NPC diagnosis [PMC7534087][PMC9924325[PMC9924325]. MIR940 has also been implicated in other cancers such as pancreatic cancer and gastric cancer [PMC7250935][PMC4944467[PMC4944467]. In summary, MIR940 is a miRNA that plays important roles in various biological processes and diseases.
a gu cccca - g g ag -- gug gug ggu gggcccgg ggagcgggg ccu g c cc cc u ||| ||| |||||||| ||||||||| ||| | | || || g cac cca uccgggCC CCUCGCCCC GGG C G gg gg u c -g ----- C A G AA aa agu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004983 |
Description | Homo sapiens hsa-miR-940 mature miRNA |
Sequence | 60 - AAGGCAGGGCCCCCGCUCCCC - 80 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
|