![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-297 |
|||||
Accession | MI0005775 (change log) | ||||
Symbol | HGNC:MIR297 | ||||
Description | Homo sapiens miR-297 stem-loop | ||||
Gene family | MIPF0000204; mir-297 | ||||
Literature search |
![]()
14 open access papers mention hsa-mir-297 | ||||
Stem-loop |
u u u - a 5' g auguaug gugcaug ugcauguaugugu u | ||||||| ||||||| ||||||||||||| 3' c uauauac cauguau auguauauauaca a a - u u u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The extents of the mature sequence are not absolutely determined in [1], but are predicted from mouse miR-297. |
||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-297 |
|
Accession | MIMAT0004450 |
Sequence |
4 - auguaugugugcaugugcaug - 24 |
Deep sequencing | 24 reads, 6 experiments |
Evidence | experimental; microarray [1], Northern [1] |
Predicted targets |
|
References |
|
1 |
PMID:17322031
"Suppression of microRNA-silencing pathway by HIV-1 during virus replication"
Science. 315:1579-1582(2007).
|