Stem-loop sequence dme-mir-956

AccessionMI0005810 (change log)
DescriptionDrosophila melanogaster miR-956 stem-loop
Gene family MIPF0001983; mir-956
Literature search

4 open access papers mention dme-mir-956
(31 sentences)

Stem-loop
   gauc   a c   -u     a        uu     a  g  gag  a     c  cuc      ccaaaugcag 
5'     guu u gug  uugga uggucucg  agcua cg au   ca gugcu gg   acuggc          u
       ||| | |||  ||||| ||||||||  ||||| || ||   || ||||| ||   ||||||          u
3'     cga g uac  aaucu accagagc  uugau gu ua   gu cacga cc   uggccg          u
   uuua   c u   cu     c        -u     -  g  -aa  -     c  aau      cagaggcccg 
Get sequence
Deep sequencing
5504021 reads, 2.91e+04 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 11773731-11773878 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-956
dme-mir-956chr3L: 11773731-11773878 [-]
dme-mir-314chr3L: 11773012-11773101 [+]
Database links

Mature sequence dme-miR-956-5p

Accession MIMAT0020850
Sequence

11 - 

guguuuggaauggucucguuagcu

 - 34

Get sequence
Deep sequencing5944 reads, 31 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-956-3p

Accession MIMAT0005469
Previous IDsdme-miR-956
Sequence

117 - 

uuucgagaccacucuaauccauu

 - 139

Get sequence
Deep sequencing5497927 reads, 46 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).