Stem-loop sequence dme-mir-958

AccessionMI0005812 (change log)
DescriptionDrosophila melanogaster miR-958 stem-loop
Gene family MIPF0000912; mir-958
Literature search

2 open access papers mention dme-mir-958
(7 sentences)

Stem-loop
   --  c    cua   c           c   cuua     u  uuaau 
5'   gg gugu   ugg aaguagaauag agg    ucaca gu     u
     || ||||   ||| ||||||||||| |||    ||||| ||      
3'   cc caca   gcu uucaucuuauc ucu    agugu cg     c
   ug  -    aca   -           u   -uag     -  ucuaa 
Get sequence
Deep sequencing
111041 reads, 2.59e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 22669289-22669380 [-]
sense
FBtr0306851 ; CR43270-RA; exon 1
Database links

Mature sequence dme-miR-958-5p

Accession MIMAT0020852
Sequence

16 - 

aguagaauagcaggcuuaucaca

 - 38

Get sequence
Deep sequencing8371 reads, 43 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-958-3p

Accession MIMAT0005471
Previous IDsdme-miR-958
Sequence

58 - 

ugagauucuucuauucuacuuu

 - 79

Get sequence
Deep sequencing102600 reads, 48 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).