Stem-loop sequence dme-mir-960

AccessionMI0005815 (change log)
DescriptionDrosophila melanogaster miR-960 stem-loop
Gene family MIPF0000897; mir-960
Literature search

1 open access papers mention dme-mir-960
(1 sentences)

Stem-loop
   g     u      ca  cu    a          c     uu  ug 
5'  gguuu guacca  uu  gagu uuccagauug auagc  ug  c
    ||||| ||||||  ||  |||| |||||||||| |||||  ||   
3'  cuaaa uauggu  aa  uuca agggucuggc uaucg  au  u
   -     c      ac  uu    c          a     uu  ca 
Get sequence
Deep sequencing
1960 reads, 134 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 5641063-5641155 [+]
antisense
FBtr0079114 ; CG31646-RA; intron 4
Clustered miRNAs
< 10kb from dme-mir-960
dme-mir-959chr2L: 5640940-5641037 [+]
dme-mir-960chr2L: 5641063-5641155 [+]
dme-mir-961chr2L: 5641191-5641279 [+]
dme-mir-962chr2L: 5641298-5641389 [+]
dme-mir-963chr2L: 5641990-5642078 [+]
dme-mir-964chr2L: 5642102-5642201 [+]
Database links

Mature sequence dme-miR-960-5p

Accession MIMAT0005474
Previous IDsdme-miR-960
Sequence

19 - 

ugaguauuccagauugcauagc

 - 40

Get sequence
Deep sequencing1395 reads, 44 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-960-3p

Accession MIMAT0020855
Sequence

57 - 

uauacggucugggacacuuuua

 - 78

Get sequence
Deep sequencing565 reads, 39 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).