|
miRBase |
|
Stem-loop sequence dme-mir-964 |
|||||
| Accession | MI0005819 | ||||
| Description | Drosophila melanogaster miR-964 stem-loop | ||||
| Gene family | MIPF0000949; mir-964 | ||||
| Stem-loop |
caauaacauau -- c c agc uguuu ugguc caa uug cuuagaauagggg uuaacuua u ||||| ||| ||| ||||||||||||| |||||||| u acuag guu aac gaaucuugucucc aauugaau g ----------- ua u a gaa uugua |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
Mature sequence dme-miR-964-5p |
|
| Accession | MIMAT0005478 |
| Previous IDs | dme-miR-964 |
| Sequence |
26 - uuagaauaggggagcuuaacuu - 47 |
| Deep sequencing | 12110 reads, 43 experiments |
| Evidence | experimental; 454 [1-2], Solexa [2] |
| Predicted targets |
|
Mature sequence dme-miR-964-3p |
|
| Accession | MIMAT0020859 |
| Sequence |
64 - aguuaaaagccucuguucuaag - 85 |
| Deep sequencing | 205 reads, 17 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 2 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|