Stem-loop sequence dme-mir-965

AccessionMI0005821 (change log)
DescriptionDrosophila melanogaster miR-965 stem-loop
Gene family MIPF0000708; mir-965
Literature search

3 open access papers mention dme-mir-965
(4 sentences)

Stem-loop
   -- a     uu    -   a          u    -         a    ugcccuu 
5'   g caaua  gcuc aac uuuugggggg aaaa cuguacguu uaug       c
     | |||||  |||| ||| |||||||||| |||| ||||||||| ||||       u
3'   c guuau  cgag uug aaaauucccc uuuu gauaugcga auac       g
   aa -     --    a   -          -    c         -    uuauagu 
Get sequence
Deep sequencing
35012 reads, 769 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 243035-243141 [-]
sense
FBtr0078144 ; kis-RA; intron 1
FBtr0299837 ; kis-RC; intron 1
FBtr0308253 ; kis-RD; intron 1
FBtr0308254 ; kis-RE; intron 1
FBtr0308255 ; kis-RF; intron 1
Database links

Mature sequence dme-miR-965-5p

Accession MIMAT0020861
Sequence

24 - 

gggguaaaacuguacguuauaug

 - 46

Get sequence
Deep sequencing5479 reads, 49 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-965-3p

Accession MIMAT0005480
Previous IDsdme-miR-965
Sequence

66 - 

uaagcguauagcuuuuccccuu

 - 87

Get sequence
Deep sequencing29240 reads, 43 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).