Stem-loop sequence dme-mir-973

AccessionMI0005830 (change log)
DescriptionDrosophila melanogaster miR-973 stem-loop
Gene family MIPF0001970; mir-973
Literature search

1 open access papers mention dme-mir-973
(1 sentences)

Stem-loop
   a  --gu   c       c   g    u gu     uuc       -ag   u 
5'  cc    cgu gacuuuu gug uugg g  ugaac   gauuuua   uau u
    ||    ||| ||||||| ||| |||| |  |||||   |||||||   |||  
3'  gg    gca uugaaga cac agcc c  acuug   cuaaagu   aua a
   -  aaac   c       a   -    u uu     --u       aaa   a 
Get sequence
Deep sequencing
701 reads, 57.1 reads per million, 35 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19551528-19551628 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-973
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
Database links

Mature sequence dme-miR-973-5p

Accession MIMAT0005489
Previous IDsdme-miR-973
Sequence

19 - 

ugguuggugguugaacuucgauuuu

 - 43

Get sequence
Deep sequencing648 reads, 31 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-973-3p

Accession MIMAT0020870
Sequence

65 - 

ucuguucauucuccgacacaag

 - 86

Get sequence
Deep sequencing52 reads, 16 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).