Stem-loop sequence dme-mir-974

AccessionMI0005831 (change log)
DescriptionDrosophila melanogaster miR-974 stem-loop
Stem-loop
   caauugucacc  u  u    u ca   gag   a     a        guuu 
5'            gg ca gucc c  agc   caa gaagu guauuugu    c
              || || |||| |  |||   ||| ||||| ||||||||     
3'            cc gu uagg g  ucg   guu cuuca uauaaacg    c
   -------uaaa  c  u    u aa   aag   a     a        agaa 
Get sequence
Deep sequencing
138 reads, 14.3 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19551678-19551778 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-974
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
Database links

Mature sequence dme-miR-974-5p

Accession MIMAT0005490
Previous IDsdme-miR-974
Sequence

25 - 

aagcgagcaaagaaguaguauu

 - 46

Get sequence
Deep sequencing95 reads, 20 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-974-3p

Accession MIMAT0020871
Sequence

65 - 

uauaacuucauuggaagcuaag

 - 86

Get sequence
Deep sequencing33 reads, 7 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).