Stem-loop sequence dme-mir-975

AccessionMI0005832 (change log)
DescriptionDrosophila melanogaster miR-975 stem-loop
Gene family MIPF0001038; mir-975
Literature search

3 open access papers mention dme-mir-975
(8 sentences)

Stem-loop
   --uu          u u     -   u        c     ---   u 
5'     gaauuuuuga u uaaac acu ccuacauc uguau   gug u
       |||||||||| | ||||| ||| |||||||| |||||   ||| u
3'     uuuagagacu a guuug uga ggguguag acaug   uac u
   acac          c c     c   -        -     gcc   g 
Get sequence
Deep sequencing
937 reads, 128 reads per million, 25 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19558753-19558843 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-975
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
dme-mir-979chrX: 19561837-19561931 [+]
Database links

Mature sequence dme-miR-975-5p

Accession MIMAT0005491
Previous IDsdme-miR-975
Sequence

16 - 

uaaacacuuccuacauccuguau

 - 38

Get sequence
Deep sequencing865 reads, 17 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-975-3p

Accession MIMAT0020872
Sequence

55 - 

acagaugugggagucguuugca

 - 76

Get sequence
Deep sequencing50 reads, 13 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).