Stem-loop sequence dme-mir-976

AccessionMI0005833 (change log)
DescriptionDrosophila melanogaster miR-976 stem-loop
Gene family MIPF0000916; mir-976
Stem-loop
   caucgcca        - g            ggccauc       gauua 
5'         ugcagugc c cggcauugguga       uccaaug     g
           |||||||| | ||||||||||||       |||||||     u
3'         acgucacg g gccguaacuacu       agguuac     u
   ----aucc        u -            auugauu       aacuc 
Get sequence
Deep sequencing
595 reads, 23.1 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19558895-19558991 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-976
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
dme-mir-979chrX: 19561837-19561931 [+]
Database links

Mature sequence dme-miR-976-5p

Accession MIMAT0020873
Sequence

23 - 

auuggugaggccaucuccaaug

 - 44

Get sequence
Deep sequencing17 reads, 7 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-976-3p

Accession MIMAT0005492
Previous IDsdme-miR-976
Sequence

60 - 

uuggauuaguuaucaucaaugc

 - 81

Get sequence
Deep sequencing521 reads, 38 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).