Stem-loop sequence dme-mir-977

AccessionMI0005834 (change log)
DescriptionDrosophila melanogaster miR-977 stem-loop
Gene family MIPF0000931; mir-977
Literature search

1 open access papers mention dme-mir-977
(79 sentences)

Stem-loop
   cgaaucaacaa    gg    c          uc       a    uucagug 
5'            acaa  uaug uuuagauaac  gaauauc cauc       u
              ||||  |||| ||||||||||  ||||||| ||||       u
3'            uguu  guac aaaucuguug  cuuauag guag       c
   ----------a    uu    u          ca       a    ucuaaag 
Get sequence
Deep sequencing
6221 reads, 765 reads per million, 31 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19559022-19559120 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-977
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
dme-mir-979chrX: 19561837-19561931 [+]
Database links

Mature sequence dme-miR-977-5p

Accession MIMAT0020874
Sequence

25 - 

uagauaacucgaauaucacauc

 - 46

Get sequence
Deep sequencing139 reads, 19 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-977-3p

Accession MIMAT0005493
Previous IDsdme-miR-977
Sequence

66 - 

ugagauauucacguugucuaa

 - 86

Get sequence
Deep sequencing6036 reads, 27 experiments
Evidence experimental; 454 [1-2], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).