Stem-loop sequence dme-mir-979

AccessionMI0005836 (change log)
DescriptionDrosophila melanogaster miR-979 stem-loop
Literature search

1 open access papers mention dme-mir-979
(1 sentences)

Stem-loop
   uacauguga            --uaca    a             cu   g 
5'          ggaugucacaaa      cuga uuuggggggaauu  uau u
            ||||||||||||      |||| |||||||||||||  |||  
3'          ccuacgguguuu      gacu aagcccuucuuaa  aua a
   -------ug            uaaucg    c             ac   u 
Get sequence
Deep sequencing
107 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19561837-19561931 [+]
antisense
FBtr0074777 ; Grip84-RC; intron 4
FBtr0301307 ; Grip84-RD; 3'UTR (exon 5)
FBtr0301308 ; Grip84-RE; intron 5
FBtr0074776 ; Grip84-RB; intron 5
FBtr0074775 ; Grip84-RA; intron 6
Clustered miRNAs
< 10kb from dme-mir-979
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
dme-mir-979chrX: 19561837-19561931 [+]
Database links

Mature sequence dme-miR-979-5p

Accession MIMAT0020876
Sequence

23 - 

acacugaauuuggggggaauucu

 - 45

Get sequence
Deep sequencing38 reads, 8 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-979-3p

Accession MIMAT0005495
Previous IDsdme-miR-979
Sequence

60 - 

uucuucccgaacucaggcuaa

 - 80

Get sequence
Deep sequencing52 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).