Stem-loop sequence dme-mir-982

AccessionMI0005839 (change log)
DescriptionDrosophila melanogaster miR-982 stem-loop
Gene family MIPF0000843; mir-982
Literature search

4 open access papers mention dme-mir-982
(39 sentences)

Stem-loop
   ----c        g    a  cu   ca     g      --au   uu 
5'      gaaaucau uuag uc  gga  aauau aaguaa    ugu  u
        |||||||| |||| ||  |||  ||||| ||||||    |||   
3'      uuuuggua aauc ag  ccu  uuaua uucauu    acg  u
   cgaga        -    a  uu   ac     g      aacu   ua 
Get sequence
Deep sequencing
1519 reads, 55.3 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 4365806-4365898 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-982
dme-mir-984chrX: 4368646-4368735 [-]
dme-mir-983-2chrX: 4368483-4368581 [-]
dme-mir-983-1chrX: 4368309-4368399 [-]
dme-mir-303chrX: 4366179-4366248 [-]
dme-mir-982chrX: 4365806-4365898 [-]
Database links

Mature sequence dme-miR-982-5p

Accession MIMAT0005498
Previous IDsdme-miR-982
Sequence

16 - 

uccuggacaaauaugaaguaaau

 - 38

Get sequence
Deep sequencing1435 reads, 47 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dme-miR-982-3p

Accession MIMAT0020879
Sequence

55 - 

uuacuugauauucauccuugaa

 - 76

Get sequence
Deep sequencing84 reads, 18 experiments
Evidence not experimental
Database links

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).